Documentation PlantQTLdb Assistant Sequence Similarity Search with BLAST
Browse Documentation
Getting Started with Assistant Gene Structure and Sequence Extraction Variant Annotation and Local QTL Evidence Functional Enrichment with g:Profiler Network Analysis with STRING Finding Sequencing Data with ENA Sequence Similarity Search with BLAST Plant Motif Analysis with JASPAR and FIMO DNA Analysis with Evo2 External Biological Evidence Sources Troubleshooting and Limitations

PlantQTLdb Assistant

Sequence Similarity Search with BLAST

submit a short DNA or protein sequence to NCBI and retrieve its local-alignment results

Requires Research mode

Open PlantQTLdb Assistant

When to use it

Look for sequences similar to an unknown fragment or check a candidate match. Current BLAST runs remotely against NCBI core_nt for blastn or swissprot for blastp; it does not use a local PlantQTLdb BLAST database.

How to ask and what you receive

  1. Wait for the indicated intervalAllow at least 60 seconds before requesting another NCBI status check.
  2. Click Check job statusThe button fills a query containing your own task token into the Research composer.
  3. Send that querySubmitting it checks progress. A running task may still need more time; do not resubmit the original sequence simply because it is pending.

Submit DNA

ask
Use BLAST to align the following DNA sequence:
>rice_test
ATGGGCGGTTCATGATGCGGCTGAAGCTGCCAAACGGTGTGACGACGAGCGAGCAGACGAGGTACCTGGCGAGCGTGATCGAGGCGTACGGCAAGGAGGGCTGCGCCGACGTGACAACCCGCCAGAACTGGCAGATCCGCGGCGTCACGCTCCCCGACGTGCC

what you receive

First, a pending/submitted result with a PlantQTLdb job token. A completed result is not guaranteed in the initial reply. Later status queries can return target descriptions, E-values, identity and coverage, plus JSON/CSV downloads.

Read alignment statistics

E-value
The expected number of chance matches at least this good under the search conditions. Smaller usually indicates stronger similarity evidence.
Identity
The fraction of identical positions within each local alignment segment (HSP).
Query coverage
The fraction of the input covered by that HSP. Overlapping HSPs are not summed; high identity over a very short segment is not full-length similarity.

Limits and interpretation

  • Submit one sequence: 20–5,000 bases for DNA or 20–2,000 residues for protein. For a protein request, write BLASTP and supply a real protein sequence.
  • Up to 10 targets are requested and up to 3 HSPs per target are retained. Actual client-side truncation is marked; returned rows are not an exhaustive database hit count.
  • Remote processing time depends on NCBI. PlantQTLdb limits active submissions and spaces progress checks; a busy response asks you to retry later.
  • A similar sequence is not automatically an ortholog. NCBI target coordinates are not automatically joined to PlantQTLdb reference coordinates or KG variants.