PlantQTLdb Assistant
Sequence Similarity Search with BLAST
submit a short DNA or protein sequence to NCBI and retrieve its local-alignment results
Requires Research mode
Open PlantQTLdb AssistantWhen to use it
Look for sequences similar to an unknown fragment or check a candidate match. Current BLAST runs remotely against NCBI core_nt for blastn or swissprot for blastp; it does not use a local PlantQTLdb BLAST database.
How to ask and what you receive
- Wait for the indicated intervalAllow at least 60 seconds before requesting another NCBI status check.
- Click Check job statusThe button fills a query containing your own task token into the Research composer.
- Send that querySubmitting it checks progress. A running task may still need more time; do not resubmit the original sequence simply because it is pending.
Submit DNA
ask
Use BLAST to align the following DNA sequence:
>rice_test
ATGGGCGGTTCATGATGCGGCTGAAGCTGCCAAACGGTGTGACGACGAGCGAGCAGACGAGGTACCTGGCGAGCGTGATCGAGGCGTACGGCAAGGAGGGCTGCGCCGACGTGACAACCCGCCAGAACTGGCAGATCCGCGGCGTCACGCTCCCCGACGTGCC
what you receive
First, a pending/submitted result with a PlantQTLdb job token. A completed result is not guaranteed in the initial reply. Later status queries can return target descriptions, E-values, identity and coverage, plus JSON/CSV downloads.
Read alignment statistics
- E-value
- The expected number of chance matches at least this good under the search conditions. Smaller usually indicates stronger similarity evidence.
- Identity
- The fraction of identical positions within each local alignment segment (HSP).
- Query coverage
- The fraction of the input covered by that HSP. Overlapping HSPs are not summed; high identity over a very short segment is not full-length similarity.
Limits and interpretation
- Submit one sequence: 20–5,000 bases for DNA or 20–2,000 residues for protein. For a protein request, write BLASTP and supply a real protein sequence.
- Up to 10 targets are requested and up to 3 HSPs per target are retained. Actual client-side truncation is marked; returned rows are not an exhaustive database hit count.
- Remote processing time depends on NCBI. PlantQTLdb limits active submissions and spaces progress checks; a busy response asks you to retry later.
- A similar sequence is not automatically an ortholog. NCBI target coordinates are not automatically joined to PlantQTLdb reference coordinates or KG variants.